Nutrient Assimilation and Adaptations Assignment

Objective: to use BLAST and other online research to assemble information about the plant with possible symbionts based on which genes are present, and present a summary of the gene names, protein functions, and place in nutrient assimilation and plant adaptations.

Main tools:

• NCBI BLAST search – Basic Local Alignment Search Tool. Finds regions of biological sequence similarity; compares nucleotide or amino acid sequences to sequences in databases and calculates statistical significance  https://blast.ncbi.nlm.nih.gov/Blast.cgi - choose NUCLEOTIDE BLAST nucleotide>nucleotide
• google search – use to find definitions of terms, genes, proteins and where they are found, what they do, more about the plant species names you encounter and links to scientific articles
• Web of Science – for additional scientific articles if needed

1. For each plant listed in the emailed list, mRNA has been isolated from plant tissues, and sequenced, and some of the sequences found (converted to DNA (AGTC) sequence) are listed.
2. You need to do a BLAST search of each of the 7 sequences for your plant, identify the gene name, function and likely location in the plant (and any special details) for each gene.
3. Collect this information for each plant and then answer the questions about what nutritional adaptations the plant has evolved to aid nutrient acquisition and assimilation.

Some important definitions: fasta is a text based format for representing either nucleotide sequences or peptide sequences, in which nucleotides or amino acids are represented using single-letter codes. The format also allows for sequence names and comments to precede the sequences.  BLAST uses fasta formatting and recognizes > at the beginning of a sequence. Fasta used from many bioinformatics application (including mass sequencing)

>Test 1 sequence

AGTGTTGGATTCAAAGCTGGTGTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGG

ATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCTGC

GGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGT

TACAAAGGACGATGCTACCTGGGCGAGCCAGTTCCAGGAGAAGAAACTCAATTTATT

Go to https://blast.ncbi.nlm.nih.gov/Blast.cgi   scroll down and choose NUCLEOTIDE BLAST nucleotide>nucleotide  and cut and paste the sequence above INCLUDING the >and name at the top, into the ‘enter query sequence’ box.

Then leaving all defaults alone, scroll down and click                              and then wait until the search is

complete (a few seconds – minute). Then scroll down and look at the output. The top one or two ‘hits’ are probably what you are looking for. With the >test 1 sequence above, you should see Arabidopsis Ribulose 1,5-bisphosphate carboxylase/oxygenase Rubisco rbcL gene at the top.

Alignment results outputs:

E value (very low is highly similar; 0.0 is essentially identical) % identity is how much is identical. Most of your data will be virtually identical to sequences in the database so will have very low E numbers. Scroll down to find the gene identities to find out what the gene you have does. Avoid complete genome, chloroplast genome options, chromosome or genomic scaffold which indicate whole genome sequencing fragments with many genes on them (increasingly common) and keep scrolling down until you find an actual gene name. For these genes, they will mostly be the first or second ‘hit’.

Record the Genus/species information, and any information about what the gene name is and what it encodes for. You can click the link and see more gene alignment details, and the ‘sequence ID’. Click this and it will get you to a page with more information about the gene, the organism and other links including scientific papers on this gene and plant or other organism. If you need to find out about these, you can google search those terms.

What you need to do to complete for this assignment:

For your plant, you need to complete the BLAST searches to identify genes and carry out follow-up research to determine the context of those genes in nutrient assimilation, adaptations and symbioses.

1. I will email you separately a set of fasta sequences which you should use for your assignment, specific to your plant
2. You need to fill out the tables for your plant and answer a series of questions in the worksheet below. The more detail you supply the better!
3. You need to include at least one full citation for a scientific paper related to the plant or symbiosis. Use the following citation format (do not include hyperlinks)

Difino MJ, Grothjan JJ, 2019. Pitcher plant enzyme analysis. Journal of Carnivorous Plants 45: 20-29.

• You need to complete the grading rubric and checklist table at the end of the worksheet
• Using a template, you will also complete a diagram of cells in the plant symbiosis you discover illustrating the pathways for nutrient assimilation, and where the proteins you identify fit in the cells of your diagrams.
• Check that you haven’t plagiarized by copying and pasting any text from a paper, website, Discussion post or other (see end of grading rubric!)
• Upload the word document worksheet (see below) with the tables and questions to Canvas, and upload a picture (as a jpg or pdf) of your diagram (or include diagram in your word document). 

EXAMPLE OF SEARCH OF GENE AND THE INFORMATION YOU SHOULD INPUT INTO THE WORKSHEET FOR EACH GENE, using the test gene from above

Worksheet questions shown in yellow

With the >test 1 sequence above, you should see Arabidopsis Ribulose 1,5-bisphosphate carboxylase/oxygenase Rubisco rbcL gene at the top.

What plant do you think this is? Include Genus, species and any major useful taxonomic information (e.g. some groups of plants are known for particular nutrient adaptations):

The plant is Arabidopsis thaliana (thale cress) which is a model plant species in the family Brassicaceae

What genes did you find and why do you think they might be present? How might the genes and the proteins they encode be involved in nutrient uptake or assimilation? Did you find genes involved in nitrogen uptake and assimilation?

Type the information into the table below, using as much space as you need.

Was there evidence for any other organisms and what do you think they are doing? Include a name but also what type of organism (e.g. bacteria, cyanobacteria, fungi…?)

No evidence for this gene (others will have some evidence)

What tissue/s, cells and/or organelles in the plant or other organism would you expect these mRNA were isolated from?

Include the citation for a scientific article related to this plant and at least one of the genes identified:

Whitney SM, Birch R, Kelso C, Beck JL, Kapralove MV. 2015. Improving recombinant Rubisco biogenesis, plant photosynthesis and growth by coexpressing its ancillary RAF1 chaperone. Proc. Natl. Acad. Sci USA 112: 3564-3569

Is there any other cool stuff you found out about the plant or the genes?  Is there any evidence for other metabolic processes or associations?

The rbcL unit is encoded on chloroplast genome, but the other part of the protein, the small subunit, is encoded by the rbcS gene which is encoded on the nuclear genome! With more than one gene, metabolic processes or associations may be more obvious!

Here to the right is a basic diagram which incorporates the rbcL gene in Rubisco. Yours will have more than one gene so will be more complex and have more details!

Nutrient Assimilation and Adaptations Assignment    Report Worksheet  

Fill in the details and answer questions below (also see grading rubric at the bottom)                              

Your name:            Jonathan Richetto                                              Plant Number: 4

What plant do you think this is? Include Genus, species and any major useful taxonomic information (e.g. some groups of plants are known for particular nutrient adaptations):

What genes did you find and why do you think they might be present? How might the genes and the proteins they encode be involved in nutrient uptake or assimilation? Did you find genes involved in nitrogen uptake and assimilation?

Type the information into the table below, using as much space as you need.

Was there evidence for any other organisms and what do you think they are doing? Include a name but also what type of organism (e.g. bacteria, cyanobacteria, fungi…?)

What tissue/s, cells and/or organelles in the plant or other organism would you expect these mRNA were isolated from?

Include the citation for a scientific article related to this plant and at least one of the genes identified:

Is there any other cool stuff you found out about the plant or the genes?  Is there any evidence for other metabolic processes or associations?

Using something like the template below, draw a diagram of a cell of this plant and any symbiotic organism, and include any assimilation pathways you can illustrate. You can draw freehand with clear labels or construct in powerpoint or other graphics package - I am not grading drawing skills, but the information you can synthesize and convey. Show transfer of things as arrows, show enzymes in circles or similar. Indicate where transmembrane transport might need a transporter… and indicate where in the cells the proteins encoded by the genes above would be located.